Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.119818 |
Chromosome: | chromosome 14 |
Location: | 3736137 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g632050 | POB25,RPG1,RPGRIP1 | Retinitis pigmentosa GTPase regulator-interacting protein 1; (1 of 1) PF11618 - First C2 domain of RPGR-interacting protein 1 (C2-C2_1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGAGGCCAAGCGGCGAGCAGGCTTCACA |
Internal bar code: | GGGTATCGACATGCAGGTAACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 740 |
LEAP-Seq percent confirming: | 97.7408 |
LEAP-Seq n confirming: | 3461 |
LEAP-Seq n nonconfirming: | 80 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGTCACACCAGACCACAC |
Suggested primer 2: | GTGGAAGGTTTGTTGGGTTG |