| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.120655 |
| Chromosome: | chromosome 3 |
| Location: | 1428840 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g151250 | LANC1,LAN1 | (1 of 1) PF05147 - Lanthionine synthetase C-like protein (LANC_like); LanC lantibiotic synthetase component C-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCACAAGCAAGGTGCCGGGGAGCGCACA |
| Internal bar code: | GTGCAAGAAGTGGTTACGGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 185 |
| LEAP-Seq percent confirming: | 99.4792 |
| LEAP-Seq n confirming: | 37056 |
| LEAP-Seq n nonconfirming: | 194 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTGTAACGCTTTGTGCT |
| Suggested primer 2: | TTCAGTTGTAAGCGGTGTCG |