Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.121659 |
Chromosome: | chromosome 13 |
Location: | 2899138 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g583550 | VIP1,VIPP1 | (1 of 2) K03969 - phage shock protein A (pspA); Vesicle inducing protein in plastids 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAACCGCCGCAGGCCGTCCACGGGACGT |
Internal bar code: | CGTTGGTTAATTCTAGGGGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 413 |
LEAP-Seq percent confirming: | 96.6204 |
LEAP-Seq n confirming: | 1601 |
LEAP-Seq n nonconfirming: | 56 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGTGTGGAATAAGAGCGG |
Suggested primer 2: | AATGTACAGCTCGGTCACCC |