Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.122642 |
Chromosome: | chromosome 3 |
Location: | 1119084 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g148950 | CGL43,SRRP1,PNT1 | Ortholog of PSII biogenesis protein SRRP1; (1 of 3) IPR003029//IPR012340//IPR022967 - S1 domain // Nucleic acid-binding, OB-fold // RNA-binding domain, S1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCTTGAAGCTGGGTGCGGCGGGGAACCG |
Internal bar code: | GGGGCATTGACGAACCTTCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 810 |
LEAP-Seq percent confirming: | 95.1078 |
LEAP-Seq n confirming: | 2294 |
LEAP-Seq n nonconfirming: | 118 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCTCTGCATTGCTTGTACG |
Suggested primer 2: | AGACCATCCAGGGACATCTG |