Insertion junction: LMJ.RY0402.122887_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.122887
Chromosome:chromosome_3
Location:3050664
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g164250 FAP262 Flagellar Associated Protein, protein kinase antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CCCGAGCATCCACCTTGTACTACATGTCAT
Internal bar code:GCGGGGAGTGAGACAGGGGGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:617
LEAP-Seq percent confirming:99.8452
LEAP-Seq n confirming:645
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:CACGACGACTTCTTGCGATA
Suggested primer 2:AAGGACGAGGAGGTGGAAGT