| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.124221 |
| Chromosome: | chromosome 7 |
| Location: | 1246019 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g321400 | MAW6,FAP113 | (1 of 1) PF13948 - Domain of unknown function (DUF4215) (DUF4215); Membrane-associated hydroxyproline-rich glycoprotein 6 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTTACTTTGTTACAGCAACGTGTGTGAA |
| Internal bar code: | TTGGTTATGAGAGCTCCCATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 649 |
| LEAP-Seq percent confirming: | 97.0757 |
| LEAP-Seq n confirming: | 1527 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATAACGTTGTCTCCGTGGC |
| Suggested primer 2: | CCACACAGCGAGACTTTTCA |