| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.124524 |
| Chromosome: | chromosome 9 |
| Location: | 1771234 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396400 | UBQ2 | Bi-ubiquitin; (1 of 1) K12158 - ubiquitin-like protein Nedd8 (NEDD8) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGACAAACGCGAAGGCGAGAGGTGACCCT |
| Internal bar code: | AGACTGAATAAGCCGCCAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 639 |
| LEAP-Seq percent confirming: | 99.8864 |
| LEAP-Seq n confirming: | 2637 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTGGTGCTGTAAGGTGGC |
| Suggested primer 2: | AGCACAGCAACAGCAACAAC |