| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.124635 |
| Chromosome: | chromosome 12 |
| Location: | 2386863 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g507300 | LCI30 | (1 of 1) K14842 - ribosome biogenesis protein NSA2 (NSA2); Low-CO2-inducible protein 30 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACTCCCCCAAGGCCACAGCCTAATCCCA |
| Internal bar code: | TCATGTTACGTTATATCTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1059 |
| LEAP-Seq percent confirming: | 99.5502 |
| LEAP-Seq n confirming: | 664 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTGGTGTAATGAAGCA |
| Suggested primer 2: | TTTGAAGGTGGTGTTGGTGA |