| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.124917 |
| Chromosome: | chromosome 2 |
| Location: | 3247994 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095077 | (1 of 1) PF00571//PF04134 - CBS domain (CBS) // Protein of unknown function, DUF393 (DUF393) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGGCCCGCGTTTCCGTCGCCGCGACCAA |
| Internal bar code: | AGGCTTGGCCAGCCGGTTCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 487 |
| LEAP-Seq percent confirming: | 99.7929 |
| LEAP-Seq n confirming: | 6265 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAAAATCAGCACCATCGGC |
| Suggested primer 2: | CTGCCTTACCACAGTCCCAT |