| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125046 |
| Chromosome: | chromosome 3 |
| Location: | 5392178 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184651 | RAD51D | DNA recombination protein; (1 of 1) PTHR22942:SF29 - DNA REPAIR PROTEIN RAD51 HOMOLOG 4 | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGCACTTGGGCCCTCGCAGTCGAGGCG |
| Internal bar code: | GAGGAGGGGGCCGAAGCCGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 633 |
| LEAP-Seq percent confirming: | 99.9789 |
| LEAP-Seq n confirming: | 4730 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCATGAAGAGCGGGAATG |
| Suggested primer 2: | ACACCGAGTCCACTACCAGC |