| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125986 |
| Chromosome: | chromosome 12 |
| Location: | 1124525 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g490350 | HDS1 | (1 of 1) 1.17.7.1 - (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase (ferredoxin) / 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGGGCGTGTAGGGTCTCGCCACCTTTTT |
| Internal bar code: | ATCGCGCGGAACGTAGCTGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 81 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATAAGAGCCCTTCGCAAAC |
| Suggested primer 2: | TTGCTTCATTGACCACCAAA |