Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.126297 |
Chromosome: | chromosome 12 |
Location: | 2008177 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g510250 | VTC1 | Vacuolar Transport Chaperone-like protein; (1 of 6) PTHR10783 - XENOTROPIC AND POLYTROPIC RETROVIRUS RECEPTOR 1-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGCGCAGGCCCCTCTCCCACCGCCTGC |
Internal bar code: | GCTACTCGGTGGTCTGTCCCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 816 |
LEAP-Seq percent confirming: | 97.1429 |
LEAP-Seq n confirming: | 68 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCAACAGCAGTTACGAGG |
Suggested primer 2: | CTCATTCCTTCAGTAGCGGC |