Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.127089 |
Chromosome: | chromosome 16 |
Location: | 4169638 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g668900 | A3,MTA3 | Hypothetical protein; (1 of 2) PTHR11266:SF41 - PXMP2/4 FAMILY PROTEIN 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGTAGTGGTCGTGCCTTGCAGCCTGTG |
Internal bar code: | CGTTGGACTTATTCTTGAATTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1051 |
LEAP-Seq percent confirming: | 54.6875 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATGCACGGATGAACAAAA |
Suggested primer 2: | CGGAGTTTTCTGAAAGCAGG |