Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.127152 |
Chromosome: | chromosome 10 |
Location: | 1014387 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g425050 | ROC59,ROC28 | (1 of 1) K11807 - WD and tetratricopeptide repeats protein 1 (WDTC1); Rhythm Of Chloroplast 59 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGCACACCGTTTCCAGGGTGCAGCACA |
Internal bar code: | GACTTGAGGTGTACTGGTGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 762 |
LEAP-Seq percent confirming: | 99.5792 |
LEAP-Seq n confirming: | 2130 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCAACTCCAGCAGACGACA |
Suggested primer 2: | GAGAGGACGATGACGAGGAG |