Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.127804 |
Chromosome: | chromosome 13 |
Location: | 4546783 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g603700 | DII4,NSG4,ACT1,IDA5 | Actin, flagellar inner arm dynein subunit; (1 of 1) K10355 - actin, other eukaryote (ACTF) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACGAGGGCGAGGTCTCTGCTCTGGTGTG |
Internal bar code: | CGCTATGGTCGAAGCTCATGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 236 |
LEAP-Seq percent confirming: | 99.8113 |
LEAP-Seq n confirming: | 1058 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCTCACGAGAGAAGGCAT |
Suggested primer 2: | CACAATACCGTGCTCAATGG |