| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.129350 |
| Chromosome: | chromosome 9 |
| Location: | 3827440 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391801 | VSP4 | (1 of 8) PTHR11339:SF290 - PROTEIN T26A8.1; Hydroxyproline-rich cell wall glycoprotein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAACTAACCAACTTAGCCATTGACCCCGC |
| Internal bar code: | TGGGTTTATGATCATAACGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 646 |
| LEAP-Seq percent confirming: | 99.4981 |
| LEAP-Seq n confirming: | 793 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGAAGAGCGGGTTGCTTG |
| Suggested primer 2: | GAGAAGGAGGAGTGAGGGCT |