| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.129460 |
| Chromosome: | chromosome 14 |
| Location: | 1847259 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g620300 | ASB1,ANS2 | Anthranilate synthase, beta subunit; (1 of 1) K01658 - anthranilate synthase component II (trpG) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAACCTCAATAACCCGTGTCTATAAACC |
| Internal bar code: | ACTTATTAATGATTCAAAACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 645 |
| LEAP-Seq percent confirming: | 99.5395 |
| LEAP-Seq n confirming: | 7350 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCACTGCCTTCTCTGAAAC |
| Suggested primer 2: | GTGTACATGGCCTCCTCGTT |