| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.129503 |
| Chromosome: | chromosome 1 |
| Location: | 4481835 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g030500 | CYG58 | (1 of 1) K11858 - ubiquitin carboxyl-terminal hydrolase 48 [EC:3.4.19.12] (USP48); Adenylate/guanylate cyclase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAAATCGAGCTGGACAGCGACACATTA |
| Internal bar code: | ATCCTGTGGCGACTGAGGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 642 |
| LEAP-Seq percent confirming: | 73.0653 |
| LEAP-Seq n confirming: | 2181 |
| LEAP-Seq n nonconfirming: | 804 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTCCGCTATCTGTACC |
| Suggested primer 2: | AAGAGCAGCCGCTATGTACG |