Insertion junction: LMJ.RY0402.129704_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.129704
Chromosome:chromosome_3
Location:3042423
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g164250 FAP262 Flagellar Associated Protein, protein kinase antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TTGTGGTCCCGCAGCTTGGCCTGCGAGGCG
Internal bar code:CGTTCCGCATTATGACGCGCGG

Confirmation - LEAP-Seq

LEAP-Seq distance:639
LEAP-Seq percent confirming:99.7378
LEAP-Seq n confirming:2663
LEAP-Seq n nonconfirming:7
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:CAAGATATCCACCCAGCGTT
Suggested primer 2:GCTCACCATAAAGCTCTGGC