| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.130012 |
| Chromosome: | chromosome 12 |
| Location: | 4278684 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g519500 | CAX1,VCX1 | (1 of 3) K07300 - Ca2+:H+ antiporter (chaA, CAX); CAX family cation antiporter, membrane protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTAAACCGGCCAGCCGACTTTGGTATG |
| Internal bar code: | GCAGAAGGGCCTAGCATTTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 865 |
| LEAP-Seq percent confirming: | 98.3112 |
| LEAP-Seq n confirming: | 815 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGCGTTGTTTTCATCTC |
| Suggested primer 2: | GTACAGGAGGGAGCTTGCAG |