Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.131571 |
Chromosome: | chromosome 3 |
Location: | 3751565 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g169850 | TSC1 | (1 of 1) PTHR10890:SF3 - CYSTEINE--TRNA LIGASE, CYTOPLASMIC; Cysteinyl-tRNA synthetase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGCGAGATGGCACGGCGCCCGCCGCGC |
Internal bar code: | CCTAGGACGTACCATATGAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 189 |
LEAP-Seq percent confirming: | 72.5204 |
LEAP-Seq n confirming: | 2040 |
LEAP-Seq n nonconfirming: | 773 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGAGAAGAAGCGGTCGTT |
Suggested primer 2: | CCTTCTCCTTCCTCCAGCTT |