| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.131571 |
| Chromosome: | chromosome 11 |
| Location: | 491127 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467597 | (1 of 1) IPR000104//IPR003439//IPR003593//IPR013525//IPR013581//IPR027417 - Antifreeze protein, type I // ABC transporter-like // AAA+ ATPase domain // ABC-2 type transporter // Plant PDR ABC transporter associated // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGGCGGCTGTAGTGGAGGGGGAGAGA |
| Internal bar code: | TCGAGGACCCGGTCCATCGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 260 |
| LEAP-Seq percent confirming: | 99.7052 |
| LEAP-Seq n confirming: | 2029 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTCTTCCTCCACTCACAG |
| Suggested primer 2: | AGTGATCCTGTACCGCAACC |