| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131776 |
| Chromosome: | chromosome 13 |
| Location: | 4701673 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g604501 | (1 of 1) IPR003613//IPR011050 - U box domain // Pectin lyase fold/virulence factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCCCCCATCCAAGGCGATGAAACCGGC |
| Internal bar code: | AAGTGTACAGTTAGCGGGGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 533 |
| LEAP-Seq percent confirming: | 91.2359 |
| LEAP-Seq n confirming: | 4112 |
| LEAP-Seq n nonconfirming: | 395 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGAAAATGGATGGAGCAT |
| Suggested primer 2: | AGATATCCCTGCAAACGTGG |