Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.131943 |
Chromosome: | chromosome 5 |
Location: | 1942606 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g241635 | (1 of 1) IPR012344//IPR014001//IPR027417 - Matrix protein, lentiviral and alpha-retroviral // Helicase superfamily 1/2, ATP-binding domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCGCTGCACGCCGGGCCGCAGCTGCGAG |
Internal bar code: | AACACTGGTACTCGGAGCCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 116 |
LEAP-Seq percent confirming: | 44.6359 |
LEAP-Seq n confirming: | 1036 |
LEAP-Seq n nonconfirming: | 1285 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGCTTTCTCTGATGCACAC |
Suggested primer 2: | TGTCATCACCCGTTCACTGT |