Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.132136 |
Chromosome: | chromosome 12 |
Location: | 2022064 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g510100 | ATG4,APG4 | Autophagy-related protein; (1 of 1) K08342 - cysteine protease ATG4 (ATG4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCGGGTGTTCATGGCCGCTGCATGTAGC |
Internal bar code: | ATACAATGAAGCAATTACAAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 835 |
LEAP-Seq percent confirming: | 99.2389 |
LEAP-Seq n confirming: | 1695 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGACCTAATGCACCACTC |
Suggested primer 2: | CTGCTAATGCGCCTCCTAAC |