| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.132321 |
| Chromosome: | chromosome 4 |
| Location: | 2951964 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224750 | VAM1,VAMP1,VAMP71 | Endosomal R-SNARE protein, Vamp7/Nyv1-family (R.III); (1 of 3) PTHR21136//PTHR21136:SF4 - SNARE PROTEINS // N-SYNAPTOBREVIN, ISOFORM J | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCAGCCAGCAATCCGCCGAACGACTCTG |
| Internal bar code: | GGTAATATATCTATAGTCGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 499 |
| LEAP-Seq percent confirming: | 99.1624 |
| LEAP-Seq n confirming: | 11720 |
| LEAP-Seq n nonconfirming: | 99 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGATAGAGGGTTGTGAGCA |
| Suggested primer 2: | GAGAGCTGTGCTGGCTTCTT |