| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.132745 |
| Chromosome: | chromosome 2 |
| Location: | 3711892 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095200 | (1 of 3) PTHR19211:SF15 - ATP-BINDING CASSETTE SUB-FAMILY F MEMBER 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGAGGTTAAAGGTAGGGTCAGACAAAGG |
| Internal bar code: | TCGAGTGCTTGTATCGAACAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 718 |
| LEAP-Seq percent confirming: | 0.662252 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1800 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGCAAGAAGAAGATTGAC |
| Suggested primer 2: | ATACATGTCACAGACCCGCA |