Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.135478 |
Chromosome: | chromosome 10 |
Location: | 2921499 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g440300 | SMC5A | (1 of 2) PTHR19306//PTHR19306:SF1 - STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 SMC5, SMC6 // STRUCTURAL MAINTENANCE OF CHROMOSOMES PROTEIN 5; Structural Maintenance of Chromosomes protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTTATGAGAGATGAGGCCAGCGATGGCT |
Internal bar code: | TAACAGACCTGTCTAGTTTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 443 |
LEAP-Seq percent confirming: | 97.931 |
LEAP-Seq n confirming: | 142 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACGGCGAGTTGAAAGAAGA |
Suggested primer 2: | GTAACCCTCCCTGCACGTTA |