Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.137264 |
Chromosome: | chromosome 1 |
Location: | 3098202 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g019250 | SNE1,GME | GDP-D-mannose 3'%252C5'-epimerase; (1 of 1) 5.1.3.18 - GDP-mannose 3,5-epimerase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTCACAACCGGATACTCCTTGCCAGGAC |
Internal bar code: | CGGAACACAGATCAAGGCCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1011 |
LEAP-Seq percent confirming: | 99.493 |
LEAP-Seq n confirming: | 10401 |
LEAP-Seq n nonconfirming: | 53 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCCTTCGACGACAAGAAGC |
Suggested primer 2: | GAGTATGCCGGTCTGTTGGT |