| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.137705 |
| Chromosome: | chromosome 10 |
| Location: | 5195735 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456851 | TMG4 | tRNA (guanine-N1)-methyltransferase; (1 of 3) 2.1.1.221 - tRNA (guanine(9)-N(1))-methyltransferase / tRNA m(1)G(9)-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTACATGCCGTAGCAGTTTGTTCACACAA |
| Internal bar code: | GCGCATGGTGAATTCCGTGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 908 |
| LEAP-Seq percent confirming: | 98.0084 |
| LEAP-Seq n confirming: | 37990 |
| LEAP-Seq n nonconfirming: | 772 |
| LEAP-Seq n unique pos: | 181 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTCCTACTGCTCCTCCAA |
| Suggested primer 2: | GTGGGAGAATGGAAAAGCAA |