| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138918 |
| Chromosome: | chromosome 5 |
| Location: | 2770606 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236950 | SRH11 | (1 of 1) K14440 - SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1 [EC:3.6.4.12] (SMARCAL1, HARP); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAATGGACAGGGGACACGACCTACGCCT |
| Internal bar code: | CAGTTGCGGCTTCCTCGTGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 786 |
| LEAP-Seq percent confirming: | 98.5881 |
| LEAP-Seq n confirming: | 6843 |
| LEAP-Seq n nonconfirming: | 98 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAATTGCCTGCCGTACATC |
| Suggested primer 2: | GTCGTTCGAGCTTTCTACGG |