| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138958 |
| Chromosome: | chromosome 2 |
| Location: | 769894 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g078750 | PUS3 | RNA pseudouridine synthase; (1 of 1) K15452 - tRNA pseudouridine synthase 2 [EC:5.4.99.-] (PUS2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCGCCGCCCTTGGCCACCGCCGACAGC |
| Internal bar code: | GGGGCCTGGTGTTGATTTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 702 |
| LEAP-Seq percent confirming: | 99.0846 |
| LEAP-Seq n confirming: | 2706 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGGACCTGCTACAACCAT |
| Suggested primer 2: | CTTTAGGGGCATGAGACTGC |