Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.139277 |
Chromosome: | chromosome 5 |
Location: | 2979204 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g238332 | PSAD,PSAD1 | Photosystem I reaction center subunit II, 20 kDa; (1 of 1) K02692 - photosystem I subunit II (psaD) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGCAGTGGGGTCCTAGAATGCACAACGA |
Internal bar code: | GTTACATGACTAAGGGGGGCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 843 |
LEAP-Seq percent confirming: | 98.6435 |
LEAP-Seq n confirming: | 7781 |
LEAP-Seq n nonconfirming: | 107 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGATGGGGTTGACGTTCT |
Suggested primer 2: | TCTCAGCATGCCTCAACAAC |