| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.139324 |
| Chromosome: | chromosome 17 |
| Location: | 3880448 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728250 | (1 of 1) PF16908//PF16910 - Vacuolar sorting-associated protein 13, N-terminal (VPS13) // Repeating coiled region of VPS13 (VPS13_mid_rpt) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGCCCAACCGGCATGCGCGTCGCGCTG |
| Internal bar code: | GCTAATCGGTGAGCCTTCCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 351 |
| LEAP-Seq percent confirming: | 94.917 |
| LEAP-Seq n confirming: | 6293 |
| LEAP-Seq n nonconfirming: | 337 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCAATGCAGGTTTAGTGT |
| Suggested primer 2: | GCGTAGTATCCTGCCCAGAG |