| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.139413 |
| Chromosome: | chromosome 10 |
| Location: | 1281973 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427150 | SPL16 | (1 of 1) K12870 - pre-mRNA-splicing factor ISY1 (ISY1); Pre-mRNA splicing factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGATTAGTGACGTTGCGTGAGAGGCTGG |
| Internal bar code: | AGACCGCCCTCTAGGCGGCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 287 |
| LEAP-Seq percent confirming: | 91.6084 |
| LEAP-Seq n confirming: | 2751 |
| LEAP-Seq n nonconfirming: | 252 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGTGCAGCGGGATAGAG |
| Suggested primer 2: | GCGCATGAGTTCACGTCTAA |