| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.139586 |
| Chromosome: | chromosome 12 |
| Location: | 3247141 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498500 | DEG1C,DEG11 | (1 of 1) PF00089//PF13180 - Trypsin (Trypsin) // PDZ domain (PDZ_2); Deg protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGATACCACTACACAGGGGGCTGTTCC |
| Internal bar code: | CGTAGCGTAGAGATCCCATGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 590 |
| LEAP-Seq percent confirming: | 98.3129 |
| LEAP-Seq n confirming: | 5128 |
| LEAP-Seq n nonconfirming: | 88 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTAGATTTGCTGCGTGTCA |
| Suggested primer 2: | ATGTTTCTCCCCAAGCCTCT |