| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.139652 |
| Chromosome: | chromosome 12 |
| Location: | 822700 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g495951 | CYN8,CYN20C,CYN20-3,ROC4 | (1 of 4) K03768 - peptidyl-prolyl cis-trans isomerase B (cyclophilin B) [EC:5.2.1.8] (PPIB, ppiB); Cyclophilin 20-3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGATCGGACCCTGCTTGGGGTGCTGTA |
| Internal bar code: | ACTACTCGAAAGCGCGGCGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 495 |
| LEAP-Seq percent confirming: | 99.4397 |
| LEAP-Seq n confirming: | 16327 |
| LEAP-Seq n nonconfirming: | 92 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCTTCCTCCCCTCTTCAC |
| Suggested primer 2: | AACCAACAGCAATCAATCCC |