Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.140130 |
Chromosome: | chromosome 13 |
Location: | 3275517 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g586050 | (1 of 1) PTHR13833:SF49 - NHL REPEAT-CONTAINING PROTEIN 2 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAATGGCCGCGTTGTTGGTGTCCGCCAC |
Internal bar code: | AGTGAAACCGACCGTCCGGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 209 |
LEAP-Seq percent confirming: | 10.5717 |
LEAP-Seq n confirming: | 294 |
LEAP-Seq n nonconfirming: | 2487 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCTGTGTCTGACTCCCAA |
Suggested primer 2: | AGGGTACCATACGGCAAGTG |