Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.140139 |
Chromosome: | chromosome 10 |
Location: | 3082871 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g441650 | (1 of 1) PF06650//PF16908 - SHR-binding domain of vacuolar-sorting associated protein 13 (SHR-BD) // Vacuolar sorting-associated protein 13, N-terminal (VPS13) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGCCTGGTTAGGGTTTGGGGTGACCGT |
Internal bar code: | GCGGATTTCTGTCAGGGTGTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 982 |
LEAP-Seq percent confirming: | 96.156 |
LEAP-Seq n confirming: | 5103 |
LEAP-Seq n nonconfirming: | 204 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTTCACTACGCCTACTCC |
Suggested primer 2: | CAATATGTGGGTGAACAGCG |