Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.140257 |
Chromosome: | chromosome 12 |
Location: | 1918597 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g510800 | CHLI2 | (1 of 2) PTHR32039//PTHR32039:SF9 - FAMILY NOT NAMED // MAGNESIUM-CHELATASE SUBUNIT CHLI-2, CHLOROPLASTIC; Magnesium chelatase subunit I, isoform 2 with histidine kinase activity | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCCCATGGACATCTCCCATACTACCGC |
Internal bar code: | TGTTGGTGAAGCCTGGTACGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 795 |
LEAP-Seq percent confirming: | 88.0597 |
LEAP-Seq n confirming: | 295 |
LEAP-Seq n nonconfirming: | 40 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGACATTGTGATCAACCGC |
Suggested primer 2: | AGTAAACATATGGCCTGGCG |