Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.142273 |
Chromosome: | chromosome 1 |
Location: | 500608 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g002787 | SRR24A,SRR24 | (1 of 1) PF00059//PF00530//PF00704//PF03762 - Lectin C-type domain (Lectin_C) // Scavenger receptor cysteine-rich domain (SRCR) // Glycosyl hydrolases family 18 (Glyco_hydro_18) // Vitelline membrane outer layer protein I (VOMI) (VOMI); Scavenger receptor cysteine-rich protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCACAAGCGCACGTCTTGGGCCCAGCAGC |
Internal bar code: | GTCGGATCGAACCTCGACACTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 355 |
LEAP-Seq percent confirming: | 99.2701 |
LEAP-Seq n confirming: | 272 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCAACGATGATGGCTCTAT |
Suggested primer 2: | TTTTGCCAGCACAATCTGAG |