| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.142541 |
| Chromosome: | chromosome 8 |
| Location: | 1701971 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g365851 | (1 of 2) 1.13.11.69//1.13.11.70 - Carlactone synthase // All-trans-10'-apo-beta-carotenal 13,14-cleaving dioxygenase / Carotenoid cleavage dioxygenase 8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGCAGTGCCGGGGGAAGCGGCGCGTGG |
| Internal bar code: | CCCCTGAGTTTTGCAGCGACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 679 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 478 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCGCGAAGAGAAAGAAAC |
| Suggested primer 2: | CCGTGCATAGAAGCAAGACA |