Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.143885 |
Chromosome: | chromosome 2 |
Location: | 3379591 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095102 | VPS5C | (1 of 4) PTHR10555:SF84 - SORTING NEXIN-8; Subunit of Retromer complex | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCGTGCTGTATGGCGGCGTGGGTGGGC |
Internal bar code: | CTTCGGCGACCCAGGGGTAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 577 |
LEAP-Seq percent confirming: | 99.5918 |
LEAP-Seq n confirming: | 1220 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGAGCCAGTCGAAGGAAAG |
Suggested primer 2: | TCAAACGGAACACTTGCTTG |