| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.144157 |
| Chromosome: | chromosome 12 |
| Location: | 4634396 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g522950 | MIND1 | Chloroplast septum site-determining protein; (1 of 1) K03609 - septum site-determining protein MinD (minD) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGACAACGCCGGAGATTACCTCCATCCGG |
| Internal bar code: | GGACACCCCGCGATGTCCCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1277 |
| LEAP-Seq percent confirming: | 98.705 |
| LEAP-Seq n confirming: | 686 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGAACAGGTGCTGAGAA |
| Suggested primer 2: | TTCACACCAACAACTGGCAT |