| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.144826 |
| Chromosome: | chromosome 3 |
| Location: | 6306116 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g193350 | DSP7 | (1 of 1) PTHR10159//PTHR10159:SF329 - DUAL SPECIFICITY PROTEIN PHOSPHATASE // PROTEIN-TYROSINE-PHOSPHATASE IBR5; Dual-specificity protein phosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCGCATTCTTTTCCCGTGACCGGGGAA |
| Internal bar code: | GGTGTCATGTACACGGTGAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1292 |
| LEAP-Seq percent confirming: | 99.6127 |
| LEAP-Seq n confirming: | 8744 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATTCTCAAGCCACCCCTT |
| Suggested primer 2: | AGGGGTTATGGCACAGTGAG |