| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.145153 |
| Chromosome: | chromosome 11 |
| Location: | 1950109 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g468356 | TPR7,TPR | (1 of 1) K09291 - nucleoprotein TPR (TPR, MLP1, MLP2); Tetratricopeptide-repeat protein 7 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGGCACGCTCCCCCCAACCCCACCTGCA |
| Internal bar code: | ATTTGTTATCGCTCGTAATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 275 |
| LEAP-Seq percent confirming: | 99.6409 |
| LEAP-Seq n confirming: | 5550 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTCACCCTGACAACACCT |
| Suggested primer 2: | ACACACCCCACATACACCCT |