Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.145602 |
Chromosome: | chromosome 3 |
Location: | 8062643 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g201250 | (1 of 1) PF01585//PF12171 - G-patch domain (G-patch) // Zinc-finger double-stranded RNA-binding (zf-C2H2_jaz) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGATACGTGGGTGGCAGATCTTCTTGT |
Internal bar code: | GGGGGGGGGACGGTCCCCATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 577 |
LEAP-Seq percent confirming: | 99.7802 |
LEAP-Seq n confirming: | 4540 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGAGCGGAAATGTATGTGG |
Suggested primer 2: | ATGGCTCATGGCTGAAAATC |