| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.147048 |
| Chromosome: | chromosome 7 |
| Location: | 4816643 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g345900 | DCL3 | Dicer-like protein; (1 of 1) PTHR11207//PTHR11207:SF0//PTHR14950 - RIBONUCLEASE III // RIBONUCLEASE 3 // HELICASE-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAATGCCCCAACGCCCGCCCGGCAGGCC |
| Internal bar code: | GCGAGTGTTGGAGCGAAGGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 98 |
| LEAP-Seq percent confirming: | 9.75564 |
| LEAP-Seq n confirming: | 523 |
| LEAP-Seq n nonconfirming: | 4838 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCAGTCTTTGAGCCCCAG |
| Suggested primer 2: | CACACTCCAATACACCCACG |