Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.147968 |
Chromosome: | chromosome 12 |
Location: | 4801941 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g524350 | HUS1 | DNA damage checkpoint protein; (1 of 1) K10903 - HUS1 checkpoint protein (HUS1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGTGCGTGCACCAAGCTTGGAGAACCC |
Internal bar code: | TGCATGCGGACGCGATAGGATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 806 |
LEAP-Seq percent confirming: | 99.5603 |
LEAP-Seq n confirming: | 2717 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAGGCACAGGGGGTAGTA |
Suggested primer 2: | GTGGTGGTGCTAGGGAGTGT |