| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149224 |
| Chromosome: | chromosome 14 |
| Location: | 968826 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g613950 | ABCA2,ABC2 | (1 of 2) 3.6.3.32 - Quaternary-amine-transporting ATPase; ABC lipid exporter 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATGGGGGGTTGCATTCATAATTGGCTG |
| Internal bar code: | GCGAGGTATGCGCAGGTGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 570 |
| LEAP-Seq percent confirming: | 99.5722 |
| LEAP-Seq n confirming: | 931 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | COULD_NOT_FIND_PRIMER |
| Suggested primer 2: | AAACACCCACACGACAAACA |